CSPP 541 -- Section 01, Spring 2000, Ridgway Scott

Bioinformatics

Homework due 30 May 00:
• p. 259 of the Setubal and Meidanis text, problem 1.
• Look at the web site

              
  http://www.tau.ac.il/~becker/course/secondary.html
  

  and count (and give the names of) all the different folds listed there.

• Book for the course: Introduction to Computational Molecular Biology by Joao Carlos Setubal and Joao Meidanis. ISBN: 0534952623.
• See the lists of books at
  • BIOINFORM BOOKSTORE
  • Cornell
  • Centre of Bioinformatcis at Peking University
• To prepare for the first lecture on 27 March 00: read the first chapter of the Setubal and Meidanis text.
• Homework due 4 April 00: p. 30 of the Setubal and Meidanis text,
  • Do problem 1. but with the sequence

    TATAGAGACATAG
    

    instead of the one in the text (hint: first do the one in the book and then check the answer in the back of the book).
  • Do problem 2. but with the sequence

    TGCCATATATGTGCCGGGGAG
    ACGGTATATACACGGCCCCTC
    

    instead of the one in the text (hint: first do the one in the book and then check the answer in the back of the book).
  • problem 3. explaining all of your reasoning in detail, and
  • problem 5. Do the problem in the text but for a 6-cutter instead of the one in the text (hint: first do the one in the book and then check the answer in the back of the book).
  Some interesting images

  ---